Cold

Cold Stress

When the weather is cold this can put stress on homeostasis because the body is exposed. The weather can cause frost bite and affect a human’s diet. The frost bite is from the organs pulling the heat from the other extremities on the body. Most often frost bite occurs on fingers and toes before any other parts of the body, while hands and toes are extremely important for humans to function. 

 The cold weather affects diet because some food items are not available when it is cold outside because plants and fruits can get frozen over.

A short-term effect to keep your body warm when it is cold is shivering. Shivering is when muscle activity works hard to help produce more heat for the body using its own resources instead of the external heat that is usually available.

Vasoconstriction is another way the body makes its own heat. It makes its own heat by constricting blood vessels to retain heat. Vasoconstriction is one facultative adaptation to the cold weather. 

A cultural adaptation is clothing such as jackets, shoes, scarves and beanies.

A Developmental adaptation would be having a greater body mass that would give us more natural coverage to keep us warm, or in other words our own fat would keep us warm.

It is important to study all environments because it could prove whether or not a certain stress really does have an impact on certain adaptations.

Race is too general and can add other reasons for cultural adaptation and developmental adaptation, while if we keep race out of the equation and it is strictly environment then all would change based on the environment and not the race.

Language

Part 1:

            I found this experiment less difficult than I had anticipated. I did the experiment with my sister and we are so close that we have can have conversations with our eyes, of course not 15 minute long conversations but maybe one or two thoughts back and forth. It was frustrating for her to be able to talk and me not be able to. However she can read my body language well so she understood if I agreed, disagreed, or understood what she was saying.  She didn’t alter the way she communicated with me because she understood what I meant by my body language and facial expressions. If my sister and I were just meeting for the first time and were from two different cultures I would feel less superior and she would feel more superior than I because she has the advantage in communicating complex ideas. One interesting habit that many people seem to do when a person does not speak the spoken language is that the person that does speak the spoken language will talk louder, when most of the time if they talked slower and/or added body language and hand signals the non-language speaking person may be able to comprehend more of what the speaking person was trying to communicate.

Part 2:

            I found this experiment to be more difficult that the first one because I am a very visual and interactive speaker. I like to use hand movement and I like to see hand movements. I lasted about 9 minutes before I gave up and got frustrated because I kept doing the things we weren’t supposed to do without realizing it. I found the conversation to be very boring when told in monotone, without facial expressions, and without gestures. My sister kept laughing at me because she could tell it was frustrating me and it made it hard to continue on a conversation. I also found her zoning out when I said long sentences, possibly because of the monotone and how boring it was. I think it is very important to have non-speech language techniques because the way you use body language, tone, and gestures are all interpreted by the person or persons you are interacting with and makes it easier to communicate emotions. There are plenty of people that have trouble reading body language and I think it is much harder to communicate and be friends with somebody that doesn’t read body language well because then they cant interpret how you are feeling. Also, most of the time people that cant read body language do not give off good body language making it harder for you to also interpret their body language. I honestly can’t think of an environmental condition where body language would not be useful. I don’t think I have ever realized how important body language is in communication.

The Piltdown Hoax

The Piltdown Hoax Started in 1912 when Charles Dawson found a bone in Piltdown village in Southern England that he claimed to be part of a human skull. After his find he invited Woodward and a paleontologist to come examine his work. After looking in the pile of gravel where the original skull was found Dawson found a jaw bone with teeth in it. The jaw bone resembled that of an ape but the teeth resembled human teeth. The trio thought they had found the missing link between ape and man in England. Though there had been findings of ancient human bones in Germany, France, and Asia before England’s discovery, England’s bones looked to be the oldest. Woodward announced the trio’s findings and it caught the attention of Arthur Keith. Arthur Keith was one of Piltdown Man’s greatest supporter. Piltdown Man went with Keith’s theory that brains were bigger before man walked on two feet when in actuality it was the opposite.

The hoax began to be questioned around WWII when new technology came out that tested the fluorine content in fossils and allowed scientist to make an educated guess around how old the fossil was. When scientists tested the Piltdown skull they found it is young and in 1953 scientists conducted a full scale analysis. This analysis would reveal that the staining on the bone was fake, the teeth had been filed down, and that the jaw bone was from an orangutan and was only around 100 years old. The first forging bone suspect was Dawson because he wanted to have high prestige in the science world but was having trouble getting in. The second suspect is Hinton, the volunteer at the museum that became a zoologist, because bones with the same filing and staining were found in his trunk in 1975.

Human faults that come into play in this scenario were probably jealousy and selfishness. Jealousy comes into play because all the scientists wanted so bad to believe that this was true because human skulls were already being found in other places such as Germany, France, and Asia but England had yet to discover such ancient remains. Then when they found out that England had found remains and they were probably the oldest out of all the other bones found around the world they wanted to believe it so they did and nobody questioned it. Jealousy and selfishness came into play because Dawson wanted a higher prestige in the science community so he forged and fooled scientists for over 40 years. These faults definitely negatively impact the scientific process because nobody went back or challenged the findings, which is one of the major steps in the scientific process is for the theory to be challenged, and because they wanted to say England not only had ancient human remains but they were the oldest no scientist was going to challenge the findings.

                The positive aspects of the scientific process that were responsible for revealing the skull to be a fraud was that it was checked not only once, but twice and by different scientists. It was first tested when testing the fluorine content came out and that revealed that it was much younger than anticipated. Then when they looked at it closer and took it apart and tested the bones it was revealed that the bones had been stained and the teeth filed down.

                I don’t think that is possible to remove the human factor from science because you need to have a thought process and almost an imagination like thought process to be able to think outside the box to come up with multiple solutions and if one doesn’t work to repeat the process. I think if we took the human factor out there would be no way to come up with that out of the box type of answer. I would not want to remove the human factor from science.

                 The life lesson that everybody should take out of this was said really well at the end of the video when the narrator said that just because they are scientist doesn’t mean they are honest and truthful gentleman. Of course he didn’t say it quite like that but that is however the basic idea. Nobody the prestige, no matter the record they have, all humans are capable of being deceitful and lying, it’s their character that will help you decide if they are the type of person to do that, not there brain. 

Comparing Primates

Lemurs:

Lemurs tend to live on Madagascar where the temperature typically is around the 50 degrees Fahrenheit. Madagascar experiences drastic weather such as monsoons and cyclones. The body size of a lemur is 30g to 9kg.  Their light body weight is important when they swing from tree to tree which is the most common form of traveling and obtaining their food. Lemurs have sexual dimorphism because of their fur. The males have darker and less patterns on their fur while females tend to have lighter fur and more patterns. The fur also allows them to blend into the forest around them to hide from predators.

Spider Monkeys:

Spider monkeys typically live in South America where there are tropical rainforest and abundant greenery around with temperatures around the 70-80 degrees Fahrenheit. Spider Monkeys also tend to be lightweight and around 9kg, like the lemurs. This also enables them to swing from tree to tree to travel and get food. They have long arms and long tails that allow them to swing more efficiently. There is not much sexual dimorphism, however females have a ‘fake penis’ that is outside of their body and have a high-pitched noise that warns enemies to stay away.

Baboons:

Baboons usually live in Africa and Arabia. Another name for baboons is Old World Monkey. These two regions have varying temperatures. Females are typically half the size of males. Baboons do not need to be as light as spider monkeys and lemurs because they take shelter in caves created by rocks and different landscapes. The biggest sexual dimorphism is the oversized canines that the males have and display to show their dominance. Male baboons can also use their canines to protect the group of baboons.

Gibbons:

Gibbons tend to live in regions around Southeast Asia where there are tropical rainforests and differing temperatures. They also swing from tree to tree like lemurs and spider monkeys and are also small and lightweight. They weigh around 10lbs to 20lbs and there is no difference in weight compared to females and males. Like the lemurs, the Gibbons sexual dimorphism is their fur. Females have lighter colored fur and males have darker colored fur. This also aids them to hide in the tress from predators.

Chimpanzees:

Chimpanzees are the closest living relatives to humans. Chimpanzees tend to live in Africa where there are rainforest and grasslands. There bodies allow them to walk on all four, walk on two feet, or swing from tree to tree. All of these traits allow them to travel and get their food more efficiently. Chimpanzees have very little sexual dimorphism; except for that male chimpanzees seem to be larger than females.

In conclusion the primates that seem to be most closely related is lemurs, spider monkeys, and gibbons. They all seem to be more lightweight and their way of travel is swinging from tree to tree. The primate most closely related to us is the chimpanzee and it is able to walk on two feet easily. Baboons do not seem to be closely related to any of the five primates describe here.

Homologous and Analogous Traits

Homologous Trait:

1.      The two different species I will be using as my example is a dolphins fin and a whales fin. Dolphins and whales are both mammals and have fins.

2.      The homologous trait between the two is that they both have fins and that means that they have a common ancestor and it indicates that there is a genetic relationship between the species.

3.      The common ancestor of these two species is the Protocetus, which ancestor is the Kutchicetus.

4.                   

                        Whales Fin                            Dolphins Fin

Analogous Trait

1.      The two different species I will be using as my example for the Analogous Trait is a bird wing and a moth wing. They both have wings and fly.

2.      The analogous trait for the both species is the wing because they both developed it independently to be able to fly. They are similar because htye are light and can stretch out when in flight, shrink when still, and also flap to push the air down and push them up.

3.      The ancestor, Theropoda, did not have wings to begin with because it was not needed. Both animals developed the trait to adapt to the needs there environment demanded of them.

4.                                  

     Moth Wing                                                Bird Wing

DNA Code

GCTATACCAAGGGAACGTTAGCTTGAGTCCCATCCATG

I believe that Thomas Malthus had the most influence on Darwin’s development on the theory of natural selection Thomas Malthus was not a scientist yet he was an economist who studied human population. He studied and understood the growth and decline of populations, which fascinated Darwin, and eventually helped him towards the conclusion of natural selection. The bullet point that coincides with Malthus’ studies would be limited resources and potential of reproducing exponentially. Malthus’ studied the growth, reproduction, and the decline, which could be from lack of resources in some cases. Darwin took these theories and ran with them when he studied in the Galapagos Islands, specifically with the shape of the beaks of the Galapagos finches. This would go back to reproduction, mating with a bird that has a suitable beak, and resources, the best beak gets the resources. This eventually goes back to Malthus’ studies. I think that Darwin could have come to his conclusion by himself but it would have taken him much longer to realize the relationship between population, resources, and reproduction, and then even longer for him to study and test the theory. The church did not prolong the publication of Darwin’s book, The Origin of Species.

http://evolution.about.com/od/Darwin/tp/People-Who-Influenced-Charles-Darwin.htm